====ViennaRNA====

The ViennaRNA package provides RNA secondary structure prediction through energy minimization, along with other functions, and was developed by the Theoretical Biochemistry Group at the Institute for Theoretical Chemistry. You can find more information on the ViennaRNA package [[https://www.tbi.univie.ac.at/RNA/#|here]].

====Enviornment Setup====

To use the ViennaRNA package we need to load its module and given dependencies. The easiest way to do this is to modify your ''.bashrc'' file in your ''$HOME'' directory.

<code>
module load perl/5.10.1
module load python/2.7.11
module load ViennaRNA
</code>

In your ''$HOME'' directory create a directory to store your data and run scripts.

<code>
razor-l2:jokinsey:~$ mkdir VIENNA-RNA-JOBS
</code>

Create the file ''test.seq'' in your new directory with the information below, as this will be the single sequence data we will process for our test.

<code>
> test
CUACGGCGCGGCGCCCUUGGCGA
</code>

====Example Job====

In the new directory create a ''PBS'' script to submit the job with the information below.

<code>
#!/bin/bash
#PBS -N ViennaRNA
#PBS -q tiny12core
#PBS -j oe
#PBS -o vienna.$PBS_JOBID
#PBS -l nodes=1:ppn=12
#PBS -l walltime=1:00:00

cd $PBS_O_WORKDIR
cp test.seq /scratch/$PBS_JOBID
cd /scratch/$PBS_JOBID

RNAfold < test.seq
RNAfold -p --MEA < test.seq

cp -r /scratch/$PBS_JOBID $PBS_O_WORKDIR/vienna.$PBS_JOBID
</code>

This job will create a directory ''vienna.$PBS_JOBID'' in the submission directory with output post script files, and the schedule file which has the command line output of the commands as well. The first command computes the best (MFE) structure for the sequence, and the second command computes the partition function and pair probabilities as well as the maximum expected accurarcy. You can find more information about these operations [[https://www.tbi.univie.ac.at/RNA/tutorial/|here]].

All thats left is to submit the job.

<code>
razor-l2:jokinsey:~/VIENNA-RNA-JOBS$ qsub vienna.pbs
</code>

Once you've run the script in the ''vienna.$PBS_JOBID'' directory there will be two post script files ''test_ss.ps'', and ''test_dp.ps'' which show the secondary structure and dot plot respectively and should look like the examples below when viewed with a post script viewer.

test_ss.ps:
{{:test_ss.png?400|}}

test_dp.ps:
{{:test_dp.png?400|}}