The ViennaRNA package provides RNA secondary structure prediction through energy minimization, along with other functions, and was developed by the Theoretical Biochemistry Group at the Institute for Theoretical Chemistry. You can find more information on the ViennaRNA package here.

To use the ViennaRNA package we need to load its module and given dependencies. The easiest way to do this is to modify your .bashrc file in your $HOME directory.

module load perl/5.10.1
module load python/2.7.11
module load ViennaRNA

In your $HOME directory create a directory to store your data and run scripts.

razor-l2:jokinsey:~$ mkdir VIENNA-RNA-JOBS

Create the file test.seq in your new directory with the information below, as this will be the single sequence data we will process for our test.

> test
CUACGGCGCGGCGCCCUUGGCGA

In the new directory create a PBS script to submit the job with the information below.

#!/bin/bash
#PBS -N ViennaRNA
#PBS -q tiny12core
#PBS -j oe
#PBS -o vienna.$PBS_JOBID
#PBS -l nodes=1:ppn=12
#PBS -l walltime=1:00:00

cd $PBS_O_WORKDIR
cp test.seq /scratch/$PBS_JOBID
cd /scratch/$PBS_JOBID

RNAfold < test.seq
RNAfold -p --MEA < test.seq

cp -r /scratch/$PBS_JOBID $PBS_O_WORKDIR/vienna.$PBS_JOBID

This job will create a directory vienna.$PBS_JOBID in the submission directory with output post script files, and the schedule file which has the command line output of the commands as well. The first command computes the best (MFE) structure for the sequence, and the second command computes the partition function and pair probabilities as well as the maximum expected accurarcy. You can find more information about these operations here.

All thats left is to submit the job.

razor-l2:jokinsey:~/VIENNA-RNA-JOBS$ qsub vienna.pbs

Once you've run the script in the vienna.$PBSJOBID directory there will be two post script files testss.ps, and test_dp.ps which show the secondary structure and dot plot respectively and should look like the examples below when viewed with a post script viewer.

testss.ps: testdp.ps: